circad | circRNAs associated with diseases

Circ_0009910
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Gastric Cancer	ICD-10	Stomach, Malignant neoplasm of unspecified (C16.9)
DBLink		PMID	30556864
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Human GC and their corresponding normal tissues were collected at the time of surgical resection from 129 patients
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TGAGAGGCATCAGTGAGGTG Reverse AAGTGCTTAAGTGGGGATGC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Liu, M, Liu, KD, Zhang, L, Cai, J, Yao, HW, Bai, YK, Zhang, ZT (2018). Circ_0009910 regulates growth and metastasis and is associated with poor prognosis in gastric cancer. Eur Rev Med Pharmacol Sci, 22, 23:8248-8256.